Dataset Authors

Dana Wetzel

Abstract

This dataset contains mRNA sequences and log fold change of the differentially expressed gene of red drum intraperitoneal injection with south Louisiana crude oil.

Comments

Extent

Dataset contains laboratory measurements of a controlled oil exposure study, no field sampling involved.

Supplemental Information

Red drum assembled nucleic acid sequence for DEG.txt - Sequences are in Fasta format as follows; >TRINITY_DN31583_c2_g1_i1 len=266 path=[244:0-265] [-1, 244, -2] GAGATATAACATGATCTTTCAGTGGCTGCT……………… Trinity is the software used to assemble the RNA sequence fragments. The DN number is the transcript ID, c#=cluster number, g#=gene number, i#= isolate number, len = is the length of the transcript in base pairs of nucleotides, path is the assembly of the transcripts. Significant differential gene expression in red drum intraperitoneal injected with Louisiana crude oil.xlsx - column A is the transcript ID number, column B is the log2Fold change of gene expression compared to the untreated control, column C is the significance of the fold change with p < 0.01, column D is the protein description from the Blast2GO analysis, column E is the GO (gene ontology) ID number, term, and category. ExposureEvents.csv - T (time, hr), Number of fish |Next generation sequencing using RNA-seq IP Injection information: I. Intrapertoneal (IP) injections of South Louisiana crude oil: This treatment, commonly used in toxicity studies, provides an opportunity to determine acute biochemical responses to direct exposure to oil. While this does not simulate normal exposure to oil, this procedure can be helpful in identifying potential biological changes. II. As recommended by other toxicity studies, fish were injected at 2 ml of crude oil per kg of fish with a 2:1 (crude oil: corn oil) carrier matrix. III. There were four fish from each species injected with the crude/corn oil mixture and 4 fish from each species injected with corn oil only. IV. The schedule for dose and sacrifice is shown in the csv file titled "Exposure Events" V. There were also two fish from each species sacrificed at time=0 to establish normal baseline values.||||

Purpose

Controlled exposure studies were used to develop genomic and other biomarkers of oil exposure.

Keywords

RNA sequencing, Red drum, Sciaenops ocellatus

UDI

R4.x267.181:0001

Date

November 2017

Point of Contact

Name

Dana Wetzel

Organization

Mote Marine Laboratory / Environmental Laboratory of Forensics Program

Funding Source

RFP-4

DOI

10.7266/N73T9F7J

Rights Information

Creative Commons License
This work is licensed under a Creative Commons Public Domain Dedication 1.0 License.

Share

COinS